martes, 24 de agosto de 2021

Artículo nº8: Dimorfismo sexual

¿Qué es el dimorfismo sexual?

El dimorfismo sexual es el conjunto de diferencias morfológicas, fisiológicas y comportamentales que caracterizan y diferencian a los dos sexos de una misma especie en mayor o menor grado.

Esta terminología se utiliza principalmente para el Reino Animal, por lo que hace referencia a las diferencias, principalmente físicas, en cuanto a forma, coloración o tamaño, entre machos y hembras de una misma especie (dioica).


Foto: www.google.es
Dimorfismo sexual en leones. El macho presenta una melena característica de la que carece la hembra.

¿En qué especies animales se presenta el dimorfismo sexual?

No todas las especies de animales presentan dimorfismo sexual. Por ejemplo, muchos reptiles tienen los órganos sexuales internos, no demuestran diferencias externas entre los especímenes de diferente sexo.


www.google.es
Carencia de dimorfismo sexual en algunas especies. Ejemplo, Pionites melanocephalus

No obstante, se presenta en la mayoría de las especies animales, pero el grado de dimorfismo sexual suele variar mucho entre unas especies y otras, No existe una pauta universal de diferenciación sexual entre animales, más allá de los mecanismos básicos de la producción de espermatozoides u óvulos (el rasgo definidor de ser macho o hembra).

Los sexos tienden a ser muy parecidos en las especies que liberan sus gametos directamente al medio, sin cortejo ni contacto sexual entre los individuos en freza (ej esponjas). Las diferencias sexuales tienden también a diluirse en las especies en que ambos sexos participan de forma activa en la cría de la descendencia (ej. pingüinos). Sin embargo, la gran mayoría de los animales caen entre ambos extremos y presentan diferencias sexuales más acusadas.

¿Qué diferencias presentan los individuos de distinto sexo?

Pueden presentar diferencias en cuanto a su morfología (robustez del esqueleto de soporte, tamaño relativo de cuernos y astas, …), coloración (críptica, llamativa, …), en cuanto a su tamaño (pequeño, grande, …), en cuanto a su masa corporal, en cuanto a su fisiología (tasa metabólica, producción y disipación de calor, coste energético del movimiento, …), rendimiento (velocidad máxima, aceleración, …), historia biológica (edad de madurez, intervalo de vida, …),  ecología (tamaño del territorio, distancia de dispersión, densidad de población, …), comportamiento, ...

En la mayoría de las especies de insectos, arañas, anfibios, reptiles, aves rapaces, etc. las hembras son más grandes que los machos, mientras que en los mamíferos el macho suele ser el de mayor tamaño, algunas veces de modo muy notable.

www.google.es
Dimorfismo sexual extremo en peces abisales. El macho (se ve abajo) es un parásito de la hembra (arriba)

¿Cómo se ha originado el dimorfismo sexual?

El dimorfismo sexual se ha originado por la selección sexual, que no depende de una lucha por la existencia, sino que opera a través del éxito diferencial en la consecución de pareja. Por ejemplo, engloba la competencia entre hembras o machos por lograr el éxito reproductor durante el apareamiento, la competición entre el esperma de distintos machos en el tracto reproductor de la hembra, el uso preferencial del esperma por las hembras, ....

¿Cómo se manifiesta el dimorfismo sexual?

El dimorfismo sexual se manifiesta de diferentes formas.

En primer lugar, los roles sexuales de machos y hembras pueden situar a cada uno en una relación diferente con respecto al entorno, causando una selección (sexual) y una respuesta distinta.

Por ejemplo, si las hembras producen numerosos gametos, la diferencia en cuestión va asociada al tamaño corporal; de ahí el mayor tamaño que se observa en una cifra elevada de especies. Además, las especiales exigencias nutricionales demandadas por la producción de óvulos y la protección de huevos y crías, tareas que a menudo recaen sobre la hembra, pueden conducir a un uso diferenciado del entorno, lo que comporta diferentes factores selectivos sobre las hembras. El mero hecho de buscar un lugar adecuado para establecer el nido podría requerir que la hembra tenga que utilizar un hábitat distinto del escogido por el macho durante la estación de nidificación.


www.google.es
Dimorfismo sexual en arañas. La hembra es más grande, ya que se encarga de producir muchos huevos

En segundo lugar, el dimorfismo sexual puede surgir a través de “luchas” entre machos por el acceso a las hembras o viceversa.

Por ejemplo, tales contiendas pueden seleccionar un armamento para el combate, como apéndices que pueden convertir en armas para la lucha, órganos de intromisión u órganos que envían señales de cortejo.


www.google.es
Dimorfismo sexual en ciervos. Los machos son más grandes y tienen astas con las que luchan por las hembras

En tercer lugar, el dimorfismo sexual podría emerger de una selección intersexual; es decir, el ejercicio directo de la elección de determinado individuo del sexo opuesto sobre la base de su apariencia y comportamiento.

Por ejemplo, con pocas excepciones, son las hembras las que escogen y los machos responden con una ostentosa exhibición de cortejo. La razón de que las hembras escojan y los machos compitan entre sí por el acceso al apareamiento guarda relación de dependencia de la asimetría general de la inversión de los progenitores que permite definir la condición de macho y de hembra. Los machos aumentan su fecundidad en relación directa con el número de apareamientos que consiguen; las hembras se hallan limitadas en el número de crías por la cuantía de huevos que pueden producir.


www.google.es
Dimorfismo sexual en faisanes. Los faisanes machos son más grandes y coloridos, ya que compiten entre ellos durante el cortejo. Las hembras tienen colores crípticos, ya que cuidan de los huevos. 

viernes, 8 de enero de 2021

Noticia nº2: Se observa el aro iris en Villalba

Durante lo poco que ha pasado del invierno hemos podido ver en Villaba el aro iris alrededor del Sol. 

El aro iris, antelia o halo es un efecto óptico en forma de disco alrededor del Sol o la Luna y se presenta como un anillo iridiscente en su circunferencia exterior. 

Usualmente se ve en lugares muy fríos, como Alaska, pero puede ocurrir en cualquier lugar, si se dan las condiciones atmosféricas adecuadas, como por ejemplo en zonas templadas cuando el aire atmosférico posea ligeras nubes cristalizadas por el frío (casi siempre del tipo cirrus). El aro iris se origina por partículas de hielo en suspensión en la parte baja de la atmósfera (troposfera) que refractan la luz generando un espectro de colores alrededor de la Luna o el Sol.

Fuente: www.google.es

Foto del autor
Tomada cerca de la Biblioteca

Foto del autor
Procede de la foto anterior, presenta mayor detalle y está más contrastada

miércoles, 16 de septiembre de 2020

Curiosidades nº1: las distancias en el Sistema Solar

Estamos acostumbrados a ver imágenes del Sistema Solar en las redes, por ejemplo, en www.google.es, como esta:

Pero, ¿esta foto es realista? La respuesta es no. En el siguiente vídeo puedes hacerte una idea de las verdaderas dimensiones del Sistema Solar. 

Si lo has entendido bien, te darás cuenta ahora, de que la siguiente foto tampoco es realista. 

Para que te hagas idea, el diámetro de la Tierra es de 12.742 km, el de la Luna de 3.464 km, y la distancia entre ellas es de 384.000 km. ¿Te atreves a hacer un dibujo realista del sistema Tierra-Luna?

lunes, 14 de septiembre de 2020

Artículo nº 7: Cripsis por camuflaje, aposematismo y mimetismo

La cripsis por camuflaje, el aposematismo y el mimetismo son tres estrategias evolutivas en relación a la apariencia de muchos tipos de seres vivos, sobre todo los insectos.

Cripsis mediante camuflaje

En este caso un ser vivo imita las características de un ambiente o un objeto, para pasar inadvertido a los sentidos de otros seres vivos. 

Su estrategia para ocultarse es muy sencilla, pues se adaptan al ambiente en el que viven, imitando su coloración, forma, relieve, movimiento, .... 

Las razones por las que se ocultan son muy variadas, por ejemplo, puede ser para no ser depredados o para poder atrapar una presa fácilmente.


Fuente: foto del autor
Algunas mantis son verdes, otras marrones, pasando desapercibidas entre las hojas verdes o las ramas secas, mientras se mueven en un vaivén que recuerda a una hoja movida por el viento. 


Fuente: foto del autor
Algunas mariposas cuando están posadas parecen una hoja, por su color, forma y relieve


Fuente: www.google.es
Algunos chinches recuerdan elementos de relieve de ramas, como la chinche espina (Umbonia Crassicornis)


El aposematismo

Con esta estrategia los seres vivos llaman poderosamente la atención como una forma de advertencia. 

Generalmente los seres vivos usan esta estrategia para evitar ser depredados. 

Estos seres vivos tienen colores muy llamativos, rojos, amarillos, negros, ... También son tóxicos o tienen un sabor desagradable para sus depredadores, lo que evita a corto o largo plazo que sean depredados. 

Fuente: foto del autor

Las zigenas son lepidópteros (polillas) que presentan colores aposemáticos, siendo muy tóxicas, ya que presentan cianuro en su organismo

Fuente: foto del autor

Los crisomélidos son escarabajos que presentan patrones aposemáticos, presentando en muchas especies colores metálicos

El mimetismo

Con esta estrategia los seres vivos copian la apariencia de otros seres vivos. 

Hay animales que sacan ventaja de aquellos que son aposemáticos, ya que al imitarlos y parecerse a ellos logran evitar que se los coman al confundirlos con los verdaderos.

Fuente: www.google.com

Los sésidos son lepidópteros (polillas) que presentan patrones aposemáticos, sin ser aposemáticos, es decir no son tóxicos ni presentan un sabor desagradable para sus depredadores. Son miméticos, ya que imitan a las avispas.

Fuente: www.google.com

Los sírfidos son dípteros (moscas) que no son tóxicos ni presentan un sabor desagradable para sus depredadores. Son miméticos, ya que imitan a las abejas. No sólo imitan a las abejas en sus colores sino también en los sonidos que producen y su comportamiento.

martes, 1 de septiembre de 2020

Artículo nº 6: Los movimientos de la Tierra (I)

El planeta Tierra presenta 4 tipos de movimientos: dos muy conocidos, la rotación y la traslación, y dos no tan conocidos, la precesión y la nutación. 

La rotación

Es el movimiento que realiza la Tierra sobre su propio eje (de rotación). Este eje está inclinado 23º 30´ con respecto al plano de la eclíptica y es imaginario. La rotación se realiza en sentido directo (contrario a las agujas del reloj). 

El tiempo que tarda la Tierra en dar una vuelta completa sobre sí misma se denomina día (terrestre) y dura 24 horas aproximadamente. 

Por extensión un día en otros astros (ej. planetas) es el tiempo que tardan dichos astros en dar una vuelta sobre sí mismos. Un día jupiteriano dura 9 horas y 50 minutos, mientras que un día venusiano dura 243 días. 


Fuente: www.google.es

La traslación

Es el movimiento que hace la Tierra con su satélite la Luna alrededor del Sol siguiendo una órbita elíptica, casi circular. La distancia media al Sol es de 150 millones de kilómetros, lo que se denomina 1 unidad astronómica. Al ser la órbita elíptica, a veces la Tierra está más cerca del Sol y a veces más lejos. La Tierra está en el perihelio, cuando está más cerca del Sol, a 147 millones de km, y está en el afelio, cuando está más lejos del Sol, a 152 millones de km. La traslación se realiza en sentido directo (contrario a las agujas del reloj). Durante el recorrido el planeta permanece en el plano de la eclíptica. 

El tiempo que tarda la Tierra en dar una vuelta completa al Sol se denomina año (terrestre) y dura 365 días aproximadamente.

Por extensión un año en otros astros (ej. planetas) es el tiempo que tardan dichos astros en dar una vuelta alrededor del Sol. Un año jupiteriano dura 11,8 años, mientras que un año venusiano dura 224 días. 


Fuente: www.google.es

La precesión

Al estar la Tierra bajo la influencia de las atracciones gravitatorias de diversos astros (Sol, Luna, …), su eje de rotación va describiendo un doble cono de 47º de abertura, cuyo vértice está en el centro de la Tierra. 

Este movimiento se efectúa en sentido inverso al de rotación, es decir en sentido retrógrado. Una vuelta completa de precesión se realiza en 25.767 años. Debido a este movimiento en unas épocas el eje de rotación apunta a la estrella polar (Polaris), pero en otras apunta a otras estrellas, como la estrella Vega. Es decir, la posición del polo celeste va cambiando a través de los siglos. 


Fuente: www.google.es

La nutación

Es la oscilación periódica del polo de la Tierra alrededor de su posición media en la esfera celeste, debido a las fuerzas externas de atracción gravitatoria entre la Luna y el Sol con la Tierra. Esta oscilación es similar al movimiento de una peonza (trompo) cuando pierde fuerza y está a punto de caerse. La Tierra se desplaza unos nueve segundos de arco cada 18,6 años, lo que supone que en una vuelta completa de precesión (25.767 años), la Tierra habrá realizado 1385 bucles. 


Fuente: www.google.es

Como consecuencia de los movimientos terrestres se dan la sucesión de los días y las noches, así como la diferente duración de los mismos, y la sucesión de las estaciones.

miércoles, 5 de febrero de 2020

Artículo nº 5: Genética (I): El ADN

Para poder entender la genética, la ciencia que estudia los genes, primero hay que saber que son los ácidos nucleicos, es decir el ADN y el ARN. Ambos son biomoléculas orgánicas constituidas por otras biomoléculas orgánicas más sencillas denominadas nucleótidos. 

El ADN

ADN es el acrónimo de ácido desoxirribonucleico. Este ácido nucleico está formado por desoxirribonucleótidos. 

Cada nucleótido del ADN (desoxirribonucleótido) está constituido por una grupo fosfato, un azúcar (la desoxirribosa) y una base nitrogenada (la adenina, la guanina, la citosina o la timina). 


El ADN está constituido por 4 tipos de nucleótidos, el de adenina, el de guanina, el de citosina y el de timina. Sus nombres se pueden abreviar con la inicial de la base nitrogenada en mayúscula (A, G, C y T). 




En la estructura primaria del ADN los nucleótidos se unen de manera secuencial en una cadena lineal. Las diferentes cadenas lineales se diferencian en el número de nucleótidos y en su secuencia concreta. Por ejemplo, una secuencia podría representarse: 5´-ATTGCCTAGCGATACCCGAT- 3´ Los números que se añaden al principio y al final, dan idea de la orientación de la cadena. Estas dos secuencias no son iguales, aunque lo parezcan: 5´-ATCGT-3´ y 5´-TGCTA-3´

Generalmente, encontramos el ADN con su estructura secundaria, esta consiste en dos cadenas de ADN con estructura primaria, unidas por puentes de hidrógeno. Esta doble cadena presenta tres características:

1. Las dos cadenas con estructura primaria son complementarias. Presentan ambas el mismo número de nucleótidos y se unen la una a la otra nucleótido a nucleótido. Si en una cadena hay un nucleótido de adenina en la de enfrente hay un nucleótido de timina y viceversa, Si en una cadena hay un nucleótido de guanina en la de enfrente hay un nucleótido de citosina y viceversa. Un ejemplo de doble cadena podría ser el siguiente: 

ATGGTGACTAGCGGTAGCGTACG
TACCACT GATCGCCATCGCATGC

Los nucleótidos de adenina y timina se unen entre sí a través de sus bases mediante dos puentes de hidrógeno, y los de guanina y citosina se unen entre sí a través de sus bases mediante tres puentes de hidrógeno. 

2. Las dos cadenas con estructura primaria son antiparalelas. Es decir, tienen orientaciones opuestas. Sólo se pueden unir entre sí de esta manera. Utilizando el ejemplo anterior, si pusiéramos números para orientar las cadenas, estas quedarían de la siguiente manera: 

5´- ATGGTGACTAGCGGTAGCGTACG-3´ 
3´- TACCACTGAT CGCCATCGCATGC- 5´

3. Las dos cadenas con estructura primaria se disponen en el espacio adoptando una forma de doble hélice. Adoptan una forma a modo de escalera de caracol, donde los grupos fosfato y los azúcares unidos de manera alterna constituirían los pasamanos, quedando en el exterior de las moléculas, y los pares de bases nitrogenadas unidas constituirían los escalones, quedando en el interior de las moléculas. 
Pero, ¿que son los genes?, los genes son fragmentos de ADN. Pero, no cualquier fragmento de ADN es un gen. Cada gen tiene información para un carácter, es decir codifica un carácter. Por lo tanto, sólo los fragmentos de ADN que codifican caracteres son genes. 

A nivel molecular a partir del ADN sólo se puede obtener directamente, más ADN, mediante el proceso de la replicación, y cualquier ARN, mediante el proceso de la transcripción. A partir de los ARNm (mensajeros) se pueden obtener proteínas mediante el proceso de la traducción. Es decir se pueden obtener proteínas indirectamente a partir del ADN. 
En realidad, los ARN y las proteínas que se pueden obtener a partir de los distintos fragmentos de ADN (los genes), son los que determinan los caracteres. Por ejemplo, una flor tiene los pétalos de color blanco o de color violeta, en función del pigmento responsable de su coloración, y este es de naturaleza proteica, es decir, es una proteína. Un gen específico determina el color concreto de la flor, es decir,  a nivel molecular a partir de un fragmento de ADN se obtiene una proteína que es la responsable del color.

domingo, 6 de octubre de 2019

Artículo nº 4: ¿Qué es la gota fría?

La gota fría se denomina más correctamente DANA que es un acrónimo que viene de Depresión Aislada en Niveles Altos. DANA hace referencia a las causas del fenómeno, mientras que gota fría hace referencia a sus efectos.

La gota fría o DANA es un fenómeno meteorológico que se da cada año coincidiendo generalmente con los inicios de otoño y primavera en la zona mediterránea occidental. Se experimenta en España sobre todo en la costa este y las Baleares, pero los efectos pueden afectar además a zonas del interior peninsular.

La DANA es una masa de aire frío que se separa de otra masa de aire frío más grande, la corriente en chorro, que se mueve a una gran altura, entre 10 y 50 Km. La gota fría se produce al chocar esta masa de aire frío procedente de la corriente en chorro, y situada sobre la parte occidental de Europa a una altura entre los 5 y 10 km, con una masa de aire más cálido y húmedo procedente del Mar Mediterráneo.

 Resultado de imagen de gota fria efectos
Foto: www.google.es

El choque de ambas masas de aire provoca grandes tormentas que tienen efectos muy perjudiciales, estos efectos serán tanto más intensos cuanto mayor sea la diferencia entre la temperatura de ambas masas de aire. Entre estos efectos los más importantes son las abundantes lluvias, que pueden llegar a ser de más de 300 litros por metro cuadrado, y cómo consecuencia de estas, las grandes inundaciones.

 
Foto: www.google.es

La duración de este fenómeno no es fija, es variable, pudiendo terminar cuando la masa de aire frío aislada de la corriente en chorro se mezcla con la masa de aire más cálida, o cuando la masa de aire frío aislada se vuelve a unir a la gran masa de aire frío de la corriente en chorro de la que procede.


domingo, 22 de septiembre de 2019

Noticia nº 1: Jabalíes en Villalba

Desde hace unos años, grupos de jabalíes hacen incursiones en la localidad de Villalba (estación). Por ejemplo, se los puede ver bastante a menudo en la urbanización Las suertes. 

Durante este verano las incursiones se han incrementado enormemente, llegando a verse en numerosas ocasiones de noche, cerca del ambulatorio y a las orillas del río. 


Hozaduras de jabalíes en zona verde cercana a ambulatorio
Fotos del autor

Los jabalíes son animales peligrosos, ya que son salvajes y no domésticos como mucha gente piensa por su parecido con los cerdos. Es importante no darles de comer ni dejar basura fuera de los contenedores, ya que esto favorece las incursiones. Si se los ve no hay que intentar tocarlos ni molestarlos, y hay que tener muy vigilados a los niños, ya que pueden atacar a los humanos y a sus mascotas. 


Jabalíes a orilla del río cerca de la Policia Local
Vídeo del autor

El Ayuntamiento de Collado Villalba está controlando este incremento de incursiones por medio de la empresa Iberavex (Gestión de Fauna Urbana, Cetrería y Medio Ambiente). Esta empresa, utiliza allí donde se localizan las poblaciones más numerosas, distintos métodos para controlarlos, desde el uso de repelentes al uso de perros pastores adiestrados. 

Se están teniendo resultados, ya que han disminuido enormemente los avistamientos. Es muy importante su control no sólo por temas de seguridad, sino también por temas sanitarios. Si se producen avistamientos se puede comunicar a la Policía Local llamando al teléfono 91 850 54 53.

domingo, 15 de septiembre de 2019

Artículo nº 3. VIH vs SIDA


En muchas ocasiones la gente confunde VIH con SIDA, pero no son términos sinónimos. El VIH es un agente patógeno, el Virus de Inmunodeficiencia Humana, que cuando parasita a algunas células humanas, produce una “enfermedad” que se denomina SIDA.

Todos los virus son parásitos obligados de las células, es decir necesitan parasitar a las células para poder generar virus hijos. Los virus hacen que las células trabajen para ellos, fabricando dichos virus hijos, pero para ello, las células necesitan partir de información genética viral en formato ADN. Las células leen la información contenida en dicho ADN viral y a partir de esta, fabrican todas las piezas de los nuevos virus y las ensamblan para formar nuevos virus.


Ciclo típico (lítico) del VIH

El VIH es un retrovirus, lo que quiere decir que su información genética está en formato ARN en vez de como en la mayoría de los virus y todas las células, que está en formato ADN. Por ello, el VIH posee una enzima denominada retrotranscriptasa o transcriptasa inversa, que es capaz de obtener una molécula de ADN a partir de la molécula de ARN viral. No obstante, este proceso es llevado a cabo por la maquinaria de la célula parasitada.

Los virus presentan dos fases, una extracelular, en la que están completos y se denominan viriones, y una intracelular, en la que se desarman, para que la célula parasitada pueda tener acceso al material genético del virus.

El virión del VIH presenta una envuelta externa proteica, denominada cápsida, de forma icosaédrica, y por fuera de esta, presenta una envoltura membranosa, formada por un trozo de membrana plasmática celular tomado de la célula previamente parasitada. Esto es asombroso, ya que el virus se hace pasar por una célula humana ante el sistema inmunitario.

Estructura del virión del VIH

El VIH no parasita cualquier célula del ser humano, sino que parasita células muy concretas del sistema inmunitario, a las que acaba matando a largo plazo. Por ello, las defensas frente a agentes extraños se ven enormemente disminuidas, debido a lo cual, la persona con dicho virus en su organismo es susceptible a muchos otros agentes patógenos, que en condiciones ordinarias no producirían síntomas, ya que serían rápidamente controlados. Al conjunto de síntomas producidos por la pérdida de defensas se le conoce como SIDA. Estos síntomas son en realidad muy variados, ya que dependen del agente patógeno que los ocasione. El SIDA es el Síndrome de InmunoDeficiencia Adquirida, es una inmunodeficiencia, ya que se producen los síntomas por una disminución en los activos del sistema inmune, y es adquirida, ya que no se tiene desde el nacimiento, sino que se adquiere después de que el virus parasite a las células.


Cuando una persona tiene un agente infeccioso en su organismo por lo general produce anticuerpos contra ese agente patógeno. Esos anticuerpos pueden detectarse en el suero sanguíneo, diciéndose de esa persona que es seropositiva. Este término se utiliza especialmente cuando el agente infeccioso es el VIH.

Seropositiva (para el VIH) no es lo mismo que cero positiva. Mucha gente confunde generalmente estos conceptos. Una persona cero positiva es una persona que del sistema sanguíneo AB0 es del grupo sanguíneo 0, y del sistema sanguíneo Rh es del grupo Rh+. Las personas cero positivas no tienen el VIH a no ser que se contagien como las demás.

Se puede tener el VIH y no tener SIDA. Primero, porque los síntomas tardan un tiempo en aparecer. Y segundo, porque a veces, cuando el ADN viral entra en una célula no se fabrican virus hijos a partir de él, sino que el ADN vírico se inserta dentro del ADN celular, quedando inactivo, pero copiándose cada vez que se divide la célula portadora, ya que cuando una célula da lugar a células hijas duplica previamente todo el material genético (ADN) que posee. Los virus pueden estar inactivos durante grandes periodos, tiempo durante el cual se extienden por las células, pero sin destruirlas ni producir síntomas. No obstante, pasado un tiempo más o menos largo, el ADN viral se separa del ADN celular y se fabrican nuevos virus a partir de él. Si eres portador del VIH, sin tratamiento, a la larga tendrás SIDA. Próximamente se hablará de los tratamientos posibles.

miércoles, 28 de agosto de 2019

Artículo nº 2. ¿Qué es el Alzheimer?


La enfermedad de Alzheimer o simplemente Alzheimer es un proceso neurodegenerativo del sistema nervioso central que se caracteriza por una muerte progresiva de neuronas en ciertas zonas del cerebro. Por ejemplo, la corteza cerebral y el hipocampo son dos de las zonas más afectadas en esta enfermedad. 

El Alzheimer tiene síntomas de demencia, siendo la demencia más frecuente de todas las conocidas actualmente. Los síntomas más característicos de esta patología son el deterioro progresivo de la memoria, el lenguaje, el conocimiento y la personalidad, que acaba con una amnesia total y una reducción de las funciones motoras.

No se conoce la causa que la produce ni existen tratamientos eficaces contra la misma. El Alzheimer no es una enfermedad mortal, pero aumenta las posibilidades de ciertos factores de riesgo que pueden causar la muerte, como accidentes urbanos y domésticos. 


Su principal factor de riesgo es el hecho de cumplir años. La prevalencia pasa de ser 0,02% en el tramo de edad de 30 a 59 años, a más de 10,8% para el tramo comprendido entre los 80 y los 89 años. Otros factores de riesgo pueden ser traumatismos en el cerebro, el aumento de los niveles de colesterol, la hipertensión, la arteriosclerosis, el tabaquismo, la obesidad y la diabetes.


Esta enfermedad fue descubierta por Alois Alzheimer, un neuropsiquiatra alemán, estudiando a una de sus pacientes, Auguste Deter, de 51 años, en el hospital de enfermos mentales y epilépticos de Francfurt. Aunque el estudio empezó en 1901, a esta patología no se la empezó a denominar Alzheimer hasta 1910, cuando aparece como tal en la octava edición del Manual de psiquiatría de Kraepelin. 



Alois Alzheimer 003.jpg
Alois Alzheimer
Fuente: www.google.es

Los dos rasgos neuronales más importantes de la enfermedad de Alzheimer son los ovillos neurofibrilares y las placas seniles. Los ovillos neurofibrilares son un conglomerado anormal de proteínas compuesto por pequeñas fibrillas entrelazadas dentro de las neuronas en casos de la enfermedad de Alzheimer, que se forman por la múltiple fosforilación de proteínas asociadas a los microtúbulos intracelulares llamadas proteínas tau. Las placas seniles son depósitos insolubles extracelulares, alrededor de las neuronas, cuyo elemento fundamental es una proteína llamada beta-amiloide. 





lunes, 8 de julio de 2019

Artículo nº 1. Especies alóctonas vs. especies autóctonas


Una especie autóctona es una especie que pertenece a una región o ecosistema determinados. También se la denomina especie nativa o indígena.

Una especie alóctona es una especie no nativa del lugar o del área en que se la considera introducida. También se la denomina foránea o exótica.

Caso concreto: cangrejos de río autóctonos y alóctonos en España

En España sólo hay una especie de cangrejo de río autóctona, el cangrejo de río europeo o cangrejo de patas blancas (Austropotamobius pallipes). 

Las principales especies alóctonas son el cangrejo de río americano (Procambarus clarkii) y el cangrejo señal (Pacifastacus leniusculus), aunque hay otras. Estas especies son hospedadoras de un hongo (Aphanomyces astaci), al que son resistentes. 

En muchas ocasiones las especies alóctonas generan problemas a las especies alóctonas. Por ejemplo, actualmente quedan muy pocos ejemplares de la especie de cangrejo de río autóctona, ya que sus ejemplares se ven gravemente afectados por una enfermedad denominada afanomicosis, causada por el hongo que portan los cangrejos alóctonos. Esto conlleva que las especies alóctonas hayan desplazado casi totalmente a la autóctona. 

Características de estas tres especies:


1. El cangrejo de río europeo o cangrejo de patas blancas (Austropotamobius pallipes).


Presenta el cuerpo de color marrón oliváceo. Las pinzas son blanquecinas en su parte inferior. El cefalotórax está dividido. El rostro tiene forma triangular.


Resultado de imagen de austropotamobius pallipes

Fuente: www.google.es

2. El cangrejo de río americano (Procambarus clarkii)

Presenta el cuerpo con un color rojo intenso. El caparazón puede presentar tonalidades verdes, negras o marrones. Las pinzas presentan muchas espinas y dientes y terminan en punta. El cefalotórax no está dividido y presenta pequeños tubérculos. El rostro tiene forma triangular.



Fuente: www.google.es
3. El cangrejo señal (Pacifastacus leniusculus)
Presenta un abdomen grueso y el cuerpo con colores verdes o marrones. El caparazón presenta tonalidades azuladas. Presenta el cefalotórax separado mediante un surco longitudinal. El rostro es rectangular con un escalón hacia la punta. Presenta unas manchas blancas donde se unen las dos piezas de cada pinza. 


Resultado de imagen de Pacifastacus leniusculus
Fuente: www.google.es